XML File Specification
To use the AFSeq program you only need two things, a FASTQ file containing the sequencing data and an XML file that specifies the barcodes you used and the alleles you are looking for. Users who want more control over the specifics of the analysis can also enter advanced parameters as described at the end of this page.
The Basic XML File
A simple example of this file can be downloaded here and is reasonably self explanatory. The XML file contains one base node called AFSeq and two child nodes called Barcodes and Alleles. The Barcodes node has to contain a child element Barcode for each barcode used. Similarly, the Alleles node contains an entry for each locus that is being investigated, as well as a Type node for each polymorphic type present. An example of this file is also shown below.
Example XML File
<AFSeq>
<!--AFSeq element contains everything you need to run the
analysis-->
<!--Barcodes contains the barcode elements-->
<Barcodes>
<!--Each barcode element contains the 6 basepairs that identify a
barcode-->
<Barcode>AGCAAT</Barcode>
<Barcode>CCTGTT</Barcode>
</Barcodes>
<!--Variants contains all the different sequence variants we are
looking for-->
<Variants>
<!--Each variant node contains a type node with the sequence for the
expected variant, there should be at least two type nodes per variant node -->
<Variant>
<Type>ACGCTGCAAGAGTGAACAACGCGCCC</Type>
<Type>ACGCTGCAAGAGTGAACAACGCCCGC</Type>
</Variant>
<Variant>
<Type>CAGATCTGAACTTCCCAGCAAGTT</Type>
<Type>CAGATCTGAACTTCCCAGCAAGCT</Type>
</Variant>
</Variants>
</AFSeq>